📖 LAMP Primer Visualizer - User Guide

🎯 Purpose

This tool helps you design and optimize LAMP primers by:

• Visualizing where primers bind on your target sequence
• Detecting dangerous hairpin structures at 3' and 5' ends
• Adjusting primer boundaries interactively to eliminate problems
• Seeing instant feedback on changes

Unlike static analysis tools, this visualizer lets you iterate and optimize your primer design in real-time.

🚀 How to Use

1. Paste Gene Sequence: Copy your target DNA sequence into the first text box
   Accepts ACGT only, case-insensitive, whitespace will be removed
2. Add Primers: Enter primers in format NAME=SEQUENCE (one per line)
   Example: F3=ACCTGATGCC
   Supports: F3, F2, F1c, B3, B2, B1c, FIP, BIP, LoopF (or LF), LoopB (or LB)
3. Click Analyze: The tool will process your input and display results
4. Check Hairpins: Look for pink (3' hairpin) or blue (5' hairpin) warnings in the table
5. Adjust Positions: Use input fields in the "Adjust Position" column to change primer boundaries
   Changes update instantly - no need to click Analyze again
6. Hover for Details: Move your mouse over any highlighted base in the sequence to see:
   • Primer name and orientation
   • Hairpin structure details (stem length, loop size)
   • Bonding region types
   • Exact genome position

💡 Interactive Features

Position Adjustment

Change the start or end position of any primer in the table:

• Type new values directly into the input fields
• Press Enter or click outside to apply changes
• Sequence extraction updates automatically
• Hairpin analysis recalculates instantly
• Visualization updates in real-time
• Popup warnings appear if primers overlap or lengths violate LAMP design rules

Mouse-Hover Tooltips

Hover over any colored base in the sequence viewer to see detailed information about what's happening at that position.

Color Coding

Primer Colors:

• F3 - Light Green
• F2 - Sky Blue
• F1c - Gold
• B3 - Light Pink
• B2 - Orange
• B1c - Lavender
• LoopF - Pale Green
• LoopB - Peach

Hairpin Warning Borders:

• 3′ Hairpin - Deep Pink ⚠️ High priority - fix recommended
• 5′ Hairpin - Dodger Blue ⚠️ Lower priority

🔬 Understanding Results

Sequence Visualization

The sequence viewer shows your gene with colored highlights for each primer. Hairpin regions have bold colored borders (pink for 3', blue for 5').

Primer Table Columns

• Name: Primer identifier (color-coded)
• Sequence: The primer sequence (for FIP/BIP, shows both parts)
• Start: Starting position in gene (1-indexed)
• End: Ending position in gene
• Orientation: Forward binding or Reverse Complement (RC)
• Hairpin: Detection status:
  • ✓ No - Safe, no hairpins detected
  • ⚠ 3′ hairpin - Dangerous 3' end folding
  • ⚠ 5′ hairpin - 5' end folding
  • Can show both: 3′ + 5′
• Adjust Position: Interactive input fields for real-time optimization

How to Fix Hairpins

1. Identify the problem: Look for pink or blue warnings in the Hairpin column
2. Hover to investigate: Mouse over the hairpin region to see stem/loop details
3. Try adjusting: Change the end position by ±2-3 bases in the "Adjust Position" column
4. Watch for updates: Hairpin status updates instantly as you type
5. Iterate: Keep adjusting until the hairpin is eliminated or minimized
6. Verify: Check that the new sequence still meets your design requirements

📝 Example Workflow

Input:

Gene Sequence:
ATGGCATTGTTACCAACTGGGCTTGCTCTGGGCCTCGTCAC...

Primers:
F3=ACCTGATGCC
F2=TGGTAACAATGCCA
FIP=GTGACGAGGCCCAGAGCAAGCCCAGTTGGTAACAATGCCA
BIP=TGTCTTTTGTCCTGGTTTTCAC
LF=CAGCAAGTTCAACGGCCCT

Process:

1. Click Analyze → Tool shows FIP has a 3′ hairpin ⚠️
2. Hover over pink region → Tooltip shows "3′ hairpin tail (stem: 4bp, loop: 6bp)"
3. Check the sequence → Last 4bp of FIP are binding to upstream region
4. Adjust FIP end position → Change from 250 to 248 (remove 2 bases)
5. Hairpin recalculates → Status changes to ✓ No
6. Success! → New primer sequence eliminates the hairpin

Result:

You've optimized your FIP primer to eliminate secondary structure issues, all without leaving the page or running external tools.

❓ Troubleshooting

Primer not found

• Check that sequence matches exactly (case-insensitive)
• Ensure no extra whitespace or special characters
• Try searching for the reverse complement manually

FIP/BIP not splitting

• Each part should be 15-35 base pairs
• Both parts must exist in the gene sequence
• Tool tries both orientations automatically

Position adjustment not working

• Make sure you've clicked "Analyze" first
• Positions must be within gene boundaries
• Check browser console (F12) for error messages

Tooltips not appearing

• Hover longer (~200ms) over the highlighted base
• Ensure your browser supports CSS pseudo-elements
• Try zooming the page to 100%

🔬 Hairpin Detection Details

What is detected:

• Stem length: 2-6 base pairs
• Loop size: 3-12 base pairs
• Scans 15bp at 3' end and 5' end

Why these parameters?

• Short stems (2bp) can still cause issues in some conditions
• Long stems (>6bp) are rare and typically caught by shorter matches
• Very large loops (>12bp) are less stable and less problematic

Both bonding regions are highlighted:

• The 3' tail (or 5' head) that folds back
• The upstream (or downstream) complement it binds to
• This helps you see the complete hairpin structure

🧬 Primer Cross-Dimer Analysis

The tool automatically detects potential cross-dimerization between all primer pairs by checking for 3' end complementarity (3-8bp matches). Dimers are sorted by severity: first by base pair count (higher bp = stronger binding), then by GC content (G≡C bonds are stronger than A=T bonds) to prioritize the most problematic interactions. This analysis updates dynamically every time you adjust primer positions in the hairpin debugging table, helping you identify and resolve primer-primer binding issues in real-time.